ID: 980784306

View in Genome Browser
Species Human (GRCh38)
Location 4:137532581-137532603
Sequence GCTGATGGAGTCACCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980784299_980784306 29 Left 980784299 4:137532529-137532551 CCCAGCGTGTGTTGAATCGCTTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 167
980784302_980784306 3 Left 980784302 4:137532555-137532577 CCAATCAGCGTGCTTCCAAATCA 0: 1
1: 0
2: 0
3: 6
4: 98
Right 980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 167
980784300_980784306 28 Left 980784300 4:137532530-137532552 CCAGCGTGTGTTGAATCGCTTCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 167
980784301_980784306 7 Left 980784301 4:137532551-137532573 CCAGCCAATCAGCGTGCTTCCAA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980784306 Original CRISPR GCTGATGGAGTCACCCAAGG AGG Intergenic
900415611 1:2533143-2533165 GCTGCTGGGGGCAGCCAAGGTGG - Intergenic
902463928 1:16602924-16602946 CCTGATGGAGTCACCATAGTGGG - Intronic
903157169 1:21453750-21453772 CCTGATGGAGTCACCATAGTGGG + Intronic
903343814 1:22671843-22671865 GCTGTTGGAGTCCCTCAGGGAGG + Intergenic
903747675 1:25599256-25599278 GCTGGAGGAGTCAGCAAAGGTGG + Intergenic
903850030 1:26300510-26300532 GCTCATGGAGGCACCTAAAGTGG - Intronic
905404818 1:37725645-37725667 GCTACTGAAGTCACCCAGGGTGG + Intronic
906954394 1:50359892-50359914 CCTGGAGGTGTCACCCAAGGAGG - Intergenic
907516838 1:54998198-54998220 GGGGATGGAGGAACCCAAGGAGG + Intergenic
907608783 1:55846853-55846875 ACTGATTGTGTCACCCATGGAGG + Intergenic
911051785 1:93677541-93677563 GCTGATGGTGAAACCCATGGAGG + Intronic
911535536 1:99095386-99095408 GCAGATGGAGTGCCCAAAGGTGG - Intergenic
915604305 1:156941117-156941139 GCTGATGCCGTCACCCAGAGAGG + Intronic
918343511 1:183586584-183586606 CCTGATGGGGTCACCCATGTAGG - Intronic
918653734 1:186998763-186998785 GGAGATGGAGTCACCCAGGTTGG + Intergenic
921214363 1:212924628-212924650 GCAGAGGGAGGCATCCAAGGAGG - Intergenic
1065761267 10:28985382-28985404 CCTAATGGAGTCACACAAGCTGG - Intergenic
1067232996 10:44425160-44425182 GCTGATGGATGGGCCCAAGGAGG + Intergenic
1067544692 10:47184463-47184485 GCTTAGGGAGTGGCCCAAGGGGG - Intergenic
1070905713 10:80071503-80071525 ACTGATGGAGTGCCCAAAGGGGG + Intergenic
1073142075 10:101254743-101254765 GATGATGGAGTGACCCTGGGAGG - Intergenic
1074325451 10:112446783-112446805 CATGACGGAGTCATCCAAGGAGG - Exonic
1074462456 10:113650738-113650760 GCACATGGAGACACCCAATGTGG + Intronic
1075029964 10:119016462-119016484 GCTGATGCAGTCAGCCGAGATGG + Intergenic
1076048453 10:127313505-127313527 GCTCATTGATTGACCCAAGGAGG - Intronic
1077081894 11:728060-728082 GCTGACGGAGGCTCCCAAGAAGG + Intergenic
1080046292 11:27811996-27812018 GCTGCTAGAGTCCCCCAAGGAGG + Intergenic
1083797617 11:65026642-65026664 GCTGATGGCTTCAGCCCAGGAGG - Intronic
1087597656 11:100273530-100273552 GCTGGAGGGGTCACTCAAGGTGG - Intronic
1088004930 11:104927885-104927907 CCTGATGATGTCACTCAAGGAGG - Intergenic
1090831495 11:130423842-130423864 GCTAATGGAGTCTTCCCAGGTGG + Intronic
1091048870 11:132349932-132349954 GCTGCTGGAATCACACAAAGGGG + Intergenic
1092200921 12:6582195-6582217 GCTGATGGTGTCCCCCGAGAAGG - Exonic
1096781004 12:53992065-53992087 GCTGATGGAGACAGACAAAGAGG + Intronic
1102370061 12:112375494-112375516 GCTGATTGACTTACCCAAGGTGG - Intronic
1102620380 12:114189941-114189963 ACTCATGGAATCACCCAAGGTGG + Intergenic
1102785359 12:115599966-115599988 GCTGATGGAATCAAGCAGGGAGG + Intergenic
1104626488 12:130360239-130360261 GGTAATGGAAACACCCAAGGTGG + Intronic
1104955255 12:132461676-132461698 GCTGAGGGAGCCACAGAAGGGGG - Intergenic
1111543703 13:89701540-89701562 GGGGATGGAGTCACCCAGGCTGG - Intergenic
1122407415 14:101508762-101508784 GGTGATGGAGACACCCAGTGGGG + Intergenic
1122569818 14:102688898-102688920 GAGGATGGAGTCCCCAAAGGCGG - Intronic
1123049390 14:105533383-105533405 GGAGAGGGAGGCACCCAAGGAGG - Intergenic
1125734902 15:41918090-41918112 CCTGATGGGGACAGCCAAGGTGG - Intronic
1127144804 15:56013303-56013325 GCTGATTGAGTTACCCTATGAGG + Intergenic
1128356854 15:66934177-66934199 GCTGATGAGGTGACTCAAGGTGG - Intergenic
1130233969 15:82117423-82117445 GCTGAGGGTGTCACCCAATAGGG + Intergenic
1131256278 15:90864729-90864751 GCTTATAGAGTCACTCAAGGCGG + Intergenic
1135657119 16:24260119-24260141 GCTGATCATGTCACTCAAGGAGG - Intronic
1137521721 16:49200706-49200728 GCTGCTGCAGTCGCCCAGGGAGG - Intergenic
1137580390 16:49630302-49630324 GATGCTGGAGACACCCGAGGTGG - Intronic
1137859337 16:51830521-51830543 GTGGATGGAGTGACCAAAGGAGG - Intergenic
1138109178 16:54309644-54309666 GCTGATGAAGTGAACAAAGGGGG + Intergenic
1138263159 16:55640126-55640148 GATGCTGGAGTCTCCCAAGCAGG - Intergenic
1140572455 16:76124144-76124166 GCGTATGGAGTCAGCCAAGATGG + Intergenic
1141635403 16:85311578-85311600 GCCCATGGAGTACCCCAAGGAGG - Intergenic
1142672297 17:1492778-1492800 GCCGATGCAGCCACCCATGGGGG + Exonic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1145017938 17:19411187-19411209 GCTGCTGGACTCACCCCAGGGGG - Exonic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146651289 17:34608115-34608137 GCTAATGGAGTGACTCCAGGAGG - Intronic
1146691970 17:34882883-34882905 GATGGTGGCGTCACCAAAGGGGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147967753 17:44202578-44202600 GCTGATGGAGACCCAAAAGGTGG + Intergenic
1148679408 17:49465096-49465118 CCTGCTGAAGACACCCAAGGAGG - Intronic
1149792995 17:59495380-59495402 ACTGATAGAGTCACTCATGGGGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150007053 17:61476496-61476518 GGTGATGGAGTCACCTAAAGGGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150788702 17:68183078-68183100 GCTGCTGGTGTGAGCCAAGGGGG - Intergenic
1151374238 17:73673250-73673272 TGAGATGGAGTCTCCCAAGGTGG - Intergenic
1151871807 17:76841683-76841705 TCTGATGCAGCCACGCAAGGGGG + Intergenic
1152635360 17:81428591-81428613 GCTGCTGGGGTCCCCCAGGGTGG - Intronic
1154172763 18:12063162-12063184 GCTCATGGGGTCACCCACTGTGG + Intergenic
1154231386 18:12559139-12559161 GCAGATGGAGCCTCCCCAGGGGG - Intronic
1155164902 18:23224264-23224286 CCTAATGGAGGCACCAAAGGAGG - Intronic
1157290125 18:46403936-46403958 TATGATGGGGTCACCCAAGTTGG - Intronic
1161062459 19:2222057-2222079 GCTGGAGGACTCATCCAAGGTGG - Exonic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1166548481 19:43649061-43649083 GCTGAAGGCGTCACCCAGGTGGG + Exonic
1166851318 19:45762895-45762917 GCAGGTGGGGTCACCCCAGGAGG + Intronic
1167628617 19:50608716-50608738 CCTGATGGAGCCACCGAAGCTGG - Intergenic
1202679586 1_KI270711v1_random:40364-40386 CCTGATGGAGTCACCATAGTGGG - Intergenic
927809660 2:26173966-26173988 GCTGATGGAACCACGCATGGGGG + Intronic
932341349 2:70964476-70964498 GCTGATGAAGTCAGCCATTGGGG + Exonic
932522743 2:72430533-72430555 GCTGCTCTAGTCTCCCAAGGAGG - Intronic
932686753 2:73877061-73877083 CATGATGGAGTCAGCCAAAGAGG + Intergenic
936015715 2:108957476-108957498 GCTCATGGAGGCCCCCCAGGGGG + Intronic
937231870 2:120402758-120402780 GCTGATGGACTGACTCAAGGTGG + Intergenic
939041464 2:137193979-137194001 GCTAATGGACTCACCCAACAGGG + Intronic
944290116 2:197995516-197995538 CCTAATGGGGTGACCCAAGGTGG + Intronic
944423634 2:199557167-199557189 GGTAATGGAGTGTCCCAAGGAGG - Intergenic
946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG + Intronic
946213799 2:218167895-218167917 GCTGCTGGAGGCAGCTAAGGTGG - Intergenic
946371723 2:219285324-219285346 GCTGATGGTGTCAAGGAAGGAGG + Exonic
947564240 2:231183945-231183967 GCTGTTGCAGCCACCCAAGCAGG + Intergenic
948090935 2:235294853-235294875 GCTGAAGGAGTGACCGAAGTGGG - Intergenic
1168772099 20:421880-421902 GCTCCTGGAGTCACCCAGGTGGG + Intronic
1172772942 20:37392212-37392234 CCTGATGGAGTGAGGCAAGGGGG - Intronic
1173870414 20:46338179-46338201 GGTGATGGACTCACCCTGGGAGG - Intergenic
1175242881 20:57562766-57562788 GCTGACGGATTCACCCTACGTGG + Exonic
1175308869 20:57997604-57997626 CTTGATGGTGTCACACAAGGAGG + Intergenic
1179275863 21:39891255-39891277 GCTGAGGCAGCCACCCACGGGGG - Intronic
1179882143 21:44297318-44297340 CCTGAAGGAGCCACCCGAGGAGG + Intronic
1181107678 22:20584620-20584642 GGTGAAGGAGGCACCCACGGGGG - Intronic
1184599881 22:45537146-45537168 GGTGATGGGGCCACCCCAGGTGG - Intronic
1185313554 22:50169672-50169694 GGTGATGGGGTCACTCACGGCGG + Intergenic
952665148 3:35895170-35895192 GCTGTTGTAATCACCCAAAGTGG - Intergenic
953966559 3:47311779-47311801 AGTGATGGAGTTACACAAGGGGG - Intronic
955335918 3:58085930-58085952 GCTGCTGGAGTCACACGAAGTGG + Intronic
959903422 3:111684820-111684842 GCTGATGAGGTCATCCAAGTGGG + Intronic
960887974 3:122416242-122416264 GCTAATGCACTCACCCAAGAAGG - Intergenic
961449297 3:126995256-126995278 GCTGAGAGAGGCACCCCAGGGGG - Intronic
965045352 3:163571272-163571294 GCTGTGGGAGGGACCCAAGGGGG + Intergenic
965263418 3:166511270-166511292 CCTGAAGGTGTCACTCAAGGAGG - Intergenic
967847825 3:194058178-194058200 GCTGAAGGACCCACCCAGGGAGG + Intergenic
968311681 3:197688734-197688756 GCTGATGGTGTCTGCCAAGTTGG - Intronic
971447442 4:26766013-26766035 GGTGATGGACTGACCCATGGTGG + Intergenic
972259228 4:37391754-37391776 GCCGATGGGGTCACCCAGCGAGG - Intronic
972665425 4:41160553-41160575 GCTGAGGGATTTGCCCAAGGCGG - Intronic
972915748 4:43876786-43876808 GCAGATGGAGTCTCCAAAGGAGG + Intergenic
974435573 4:61853211-61853233 GCTAATGGGGTGACCCAAAGTGG - Intronic
978983841 4:114984206-114984228 GCTGATGGAGTCACCCAGGCTGG + Intronic
980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG + Intergenic
982198800 4:152939651-152939673 AGTGATGGACTCTCCCAAGGAGG - Intronic
986540255 5:8838141-8838163 ACTGATGGAGGAACCCAAGAGGG - Intergenic
991105389 5:62837085-62837107 ACAGTTGGAGTCATCCAAGGTGG + Intergenic
995015271 5:107302515-107302537 GCTGATGGGGTGACCCAGGGTGG + Intergenic
995214753 5:109582547-109582569 GCTGATGCTGACACCCAAGTAGG + Intergenic
996703416 5:126472514-126472536 GGGTATGGAGTCACCCAAGATGG + Intronic
997092148 5:130870771-130870793 GCTGATGTCGTCCCCCAAGGAGG - Intergenic
998544199 5:143012284-143012306 ACTGAAGGAGTCGCCCAAGAAGG - Intronic
1002200283 5:177524171-177524193 CCTGGTGCACTCACCCAAGGAGG + Exonic
1002468927 5:179423055-179423077 GCTGATGAGGTCACCTGAGGCGG + Intergenic
1002661784 5:180796244-180796266 GCTGGTGAAGTCTCCCCAGGAGG - Intronic
1004012319 6:11701779-11701801 GTTGAATGAGTCACCCAAGATGG + Intergenic
1004162566 6:13227871-13227893 GGTGATGGGGTCACCAAAGCAGG + Exonic
1007290875 6:40785794-40785816 GCTGATGTAGTTAGCCAAGTGGG + Intergenic
1007358306 6:41336470-41336492 GGTGATGGAGGCACCAAAAGGGG - Intronic
1007691134 6:43702317-43702339 GCTGATGGAATCATCCAGGCAGG - Intergenic
1012377522 6:98580459-98580481 CCTGATGGATTTACCCAAAGCGG + Intergenic
1013288041 6:108697640-108697662 GCTGAGGGTGTCTCCCATGGAGG + Intergenic
1021526517 7:21594630-21594652 GGTGATAGAGTCAGCCAAGTGGG + Intronic
1024481811 7:49871077-49871099 GCTAATGGAGCCATCCAAGAAGG + Intronic
1025191449 7:56898728-56898750 GCTGATGGAGTAAGCCACGTGGG - Intergenic
1025680499 7:63678206-63678228 GCTGATGGAGTAAGCCACGTGGG + Intergenic
1026591591 7:71700690-71700712 CCTGATGGAGTCAGCCAACTAGG - Intronic
1028112340 7:86956832-86956854 TGTGATGAGGTCACCCAAGGGGG + Intronic
1028998703 7:97129992-97130014 CCTGATGCTGGCACCCAAGGTGG - Intronic
1032268622 7:130384938-130384960 GCTGATGGACACACCCAGGGAGG - Intronic
1032419299 7:131764973-131764995 GCTGATGGAGGCACCCATGGTGG + Intergenic
1032579444 7:133090979-133091001 GCTCAGGGAGGCACCCAAGATGG + Intergenic
1032713388 7:134482823-134482845 GCTGATGTAGCAACTCAAGGTGG - Intergenic
1034492921 7:151403846-151403868 GCGGCTGGAGACACCCAAGATGG + Intronic
1035130499 7:156648257-156648279 TGTGTTGGAGTCACACAAGGTGG + Intronic
1036659823 8:10700750-10700772 GAAGATGGAGCCACCCATGGGGG + Intronic
1037480160 8:19297594-19297616 GCAGATGAAGTCACCCAAGCAGG + Intergenic
1039115028 8:34083651-34083673 CCTGAAAGAGTCACCCAAAGTGG + Intergenic
1045485620 8:102628634-102628656 GCTGATGAAGTTATCCAATGTGG + Intergenic
1049255301 8:141610565-141610587 GGTGGAGGGGTCACCCAAGGAGG + Intergenic
1049467021 8:142756191-142756213 GGTGGAGGGGTCACCCAAGGAGG - Intergenic
1049485626 8:142858461-142858483 GCTGAGGGAGTCCCACATGGGGG - Intronic
1049640338 8:143712381-143712403 GCTGGTGGTGACAGCCAAGGGGG + Intronic
1050329426 9:4530667-4530689 GATGGTGGAGTCACCCATGACGG + Intronic
1057405964 9:94771071-94771093 GCTGATGGAGGCAGCCTTGGGGG + Intronic
1060260720 9:122071506-122071528 GCTGAGGGAGTGGCCCAAAGAGG - Intronic
1061013370 9:127968210-127968232 GGTGGTTGATTCACCCAAGGAGG + Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1186894377 X:13991361-13991383 GCTGCTGCAGTCATCCTAGGAGG - Intergenic
1189351189 X:40277029-40277051 GCTGACGGGGACACACAAGGAGG + Intergenic
1191881507 X:65847671-65847693 GCTGATGCTGTCATACAAGGAGG - Intergenic
1198168183 X:134077921-134077943 GCTGCTGGAGAAACCCAAGAAGG - Intergenic