ID: 980784380

View in Genome Browser
Species Human (GRCh38)
Location 4:137533058-137533080
Sequence AAGTATTTACAGAGGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980784380_980784393 19 Left 980784380 4:137533058-137533080 CCCCACTCCCTCTGTAAATACTT No data
Right 980784393 4:137533100-137533122 AGCACAAGCAGATTTTCTTGGGG No data
980784380_980784391 17 Left 980784380 4:137533058-137533080 CCCCACTCCCTCTGTAAATACTT No data
Right 980784391 4:137533098-137533120 GGAGCACAAGCAGATTTTCTTGG No data
980784380_980784387 -4 Left 980784380 4:137533058-137533080 CCCCACTCCCTCTGTAAATACTT No data
Right 980784387 4:137533077-137533099 ACTTGGGCCTTTCTCCTTCCAGG No data
980784380_980784392 18 Left 980784380 4:137533058-137533080 CCCCACTCCCTCTGTAAATACTT No data
Right 980784392 4:137533099-137533121 GAGCACAAGCAGATTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980784380 Original CRISPR AAGTATTTACAGAGGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr