ID: 980786602 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:137564088-137564110 |
Sequence | TCCTCTCTATGTGGTTCTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
980786602_980786607 | 10 | Left | 980786602 | 4:137564088-137564110 | CCAGCAGAACCACATAGAGAGGA | No data | ||
Right | 980786607 | 4:137564121-137564143 | TGGCTCAAAAATTAAAGCTCAGG | No data | ||||
980786602_980786606 | -10 | Left | 980786602 | 4:137564088-137564110 | CCAGCAGAACCACATAGAGAGGA | No data | ||
Right | 980786606 | 4:137564101-137564123 | ATAGAGAGGAAGAGGAGGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
980786602 | Original CRISPR | TCCTCTCTATGTGGTTCTGC TGG (reversed) | Intergenic | ||