ID: 980786602

View in Genome Browser
Species Human (GRCh38)
Location 4:137564088-137564110
Sequence TCCTCTCTATGTGGTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980786602_980786607 10 Left 980786602 4:137564088-137564110 CCAGCAGAACCACATAGAGAGGA No data
Right 980786607 4:137564121-137564143 TGGCTCAAAAATTAAAGCTCAGG No data
980786602_980786606 -10 Left 980786602 4:137564088-137564110 CCAGCAGAACCACATAGAGAGGA No data
Right 980786606 4:137564101-137564123 ATAGAGAGGAAGAGGAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980786602 Original CRISPR TCCTCTCTATGTGGTTCTGC TGG (reversed) Intergenic