ID: 980786791

View in Genome Browser
Species Human (GRCh38)
Location 4:137566345-137566367
Sequence CCACTCTACTTAGGAAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980786787_980786791 23 Left 980786787 4:137566299-137566321 CCTAAAATTAGATTAATGAAGGT No data
Right 980786791 4:137566345-137566367 CCACTCTACTTAGGAAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980786791 Original CRISPR CCACTCTACTTAGGAAATAT GGG Intergenic
No off target data available for this crispr