ID: 980787254

View in Genome Browser
Species Human (GRCh38)
Location 4:137571749-137571771
Sequence TCTAGTCCTGTATTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980787252_980787254 5 Left 980787252 4:137571721-137571743 CCAGTCAATCATAGGTTTGGTCT 0: 18
1: 108
2: 451
3: 1056
4: 2455
Right 980787254 4:137571749-137571771 TCTAGTCCTGTATTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980787254 Original CRISPR TCTAGTCCTGTATTTCTTGG AGG Intergenic
No off target data available for this crispr