ID: 980790429

View in Genome Browser
Species Human (GRCh38)
Location 4:137613267-137613289
Sequence CGTCAAGCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980790429_980790439 24 Left 980790429 4:137613267-137613289 CCATCCACCACTGCTGCTTGACG No data
Right 980790439 4:137613314-137613336 CCATCCCTGCGGATCCTGCAGGG No data
980790429_980790435 13 Left 980790429 4:137613267-137613289 CCATCCACCACTGCTGCTTGACG No data
Right 980790435 4:137613303-137613325 GCCGCTGACTTCCATCCCTGCGG No data
980790429_980790437 23 Left 980790429 4:137613267-137613289 CCATCCACCACTGCTGCTTGACG No data
Right 980790437 4:137613313-137613335 TCCATCCCTGCGGATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980790429 Original CRISPR CGTCAAGCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr