ID: 980792040

View in Genome Browser
Species Human (GRCh38)
Location 4:137632536-137632558
Sequence GGCCACAGCATTTCAAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980792040_980792049 16 Left 980792040 4:137632536-137632558 CCACCCTTTGAAATGCTGTGGCC No data
Right 980792049 4:137632575-137632597 CTTGGCCCCTCCAGTCCAGTAGG No data
980792040_980792046 -2 Left 980792040 4:137632536-137632558 CCACCCTTTGAAATGCTGTGGCC No data
Right 980792046 4:137632557-137632579 CCAGAGGTCCAGGAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980792040 Original CRISPR GGCCACAGCATTTCAAAGGG TGG (reversed) Intergenic
No off target data available for this crispr