ID: 980794050

View in Genome Browser
Species Human (GRCh38)
Location 4:137658282-137658304
Sequence CAAGATAATGCCCTCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980794050_980794053 17 Left 980794050 4:137658282-137658304 CCCCTCTGGAGGGCATTATCTTG No data
Right 980794053 4:137658322-137658344 TTTTACTTTTTTTTAGAGACAGG 0: 4
1: 170
2: 3149
3: 32719
4: 83061
980794050_980794054 18 Left 980794050 4:137658282-137658304 CCCCTCTGGAGGGCATTATCTTG No data
Right 980794054 4:137658323-137658345 TTTACTTTTTTTTAGAGACAGGG 0: 6
1: 194
2: 3442
3: 32014
4: 68300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980794050 Original CRISPR CAAGATAATGCCCTCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr