ID: 980816233

View in Genome Browser
Species Human (GRCh38)
Location 4:137950092-137950114
Sequence AAACCAATCCTAGTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980816233_980816234 5 Left 980816233 4:137950092-137950114 CCAGTGAGAACTAGGATTGGTTT No data
Right 980816234 4:137950120-137950142 CATAATTCCATATTTCTCAGAGG 0: 26
1: 194
2: 403
3: 965
4: 7533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980816233 Original CRISPR AAACCAATCCTAGTTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr