ID: 980822970

View in Genome Browser
Species Human (GRCh38)
Location 4:138040139-138040161
Sequence CTCCATCATCAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980822970_980822976 17 Left 980822970 4:138040139-138040161 CCCAGTTCCATCTGATGATGGAG No data
Right 980822976 4:138040179-138040201 GACTTTATGGTATGATGTATAGG No data
980822970_980822974 4 Left 980822970 4:138040139-138040161 CCCAGTTCCATCTGATGATGGAG No data
Right 980822974 4:138040166-138040188 GGTGTGCATGCCTGACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980822970 Original CRISPR CTCCATCATCAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr