ID: 980822972

View in Genome Browser
Species Human (GRCh38)
Location 4:138040145-138040167
Sequence TCCATCTGATGATGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980822967_980822972 -8 Left 980822967 4:138040130-138040152 CCCTCAGGGCCCAGTTCCATCTG No data
Right 980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG No data
980822964_980822972 23 Left 980822964 4:138040099-138040121 CCTGGCAACTTTTTCACGCAACT No data
Right 980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG No data
980822968_980822972 -9 Left 980822968 4:138040131-138040153 CCTCAGGGCCCAGTTCCATCTGA No data
Right 980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980822972 Original CRISPR TCCATCTGATGATGGAGTGC TGG Intergenic
No off target data available for this crispr