ID: 980823695

View in Genome Browser
Species Human (GRCh38)
Location 4:138048509-138048531
Sequence GACCTCCACCCTAAGTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980823689_980823695 18 Left 980823689 4:138048468-138048490 CCTGGCCACAGCAAAGAGGAAGC 0: 1
1: 0
2: 2
3: 39
4: 249
Right 980823695 4:138048509-138048531 GACCTCCACCCTAAGTATTCAGG 0: 1
1: 0
2: 0
3: 1
4: 51
980823691_980823695 13 Left 980823691 4:138048473-138048495 CCACAGCAAAGAGGAAGCTTGGG 0: 1
1: 0
2: 0
3: 21
4: 250
Right 980823695 4:138048509-138048531 GACCTCCACCCTAAGTATTCAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980823695 Original CRISPR GACCTCCACCCTAAGTATTC AGG Intergenic
901074546 1:6545137-6545159 GACCTCAAGGCTAAATATTCAGG + Exonic
918458796 1:184754833-184754855 GCCCTCCGCCCTCAGTATCCCGG + Exonic
1065430800 10:25653486-25653508 GACCTCACCCCAAAGAATTCTGG + Intergenic
1068213091 10:53947690-53947712 AAAATCCATCCTAAGTATTCTGG - Intronic
1071921312 10:90354126-90354148 GACCTCCTTCTTAGGTATTCTGG + Intergenic
1079352137 11:19700633-19700655 GACCTCCACCCGAAGCACACTGG + Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084935933 11:72586610-72586632 CACCACCACCCTAAGATTTCTGG - Intronic
1085045932 11:73353364-73353386 GACCTCCACCCTATCTTTACTGG + Intronic
1085911322 11:80830027-80830049 GACCTCCACTCTCAGTCTTTGGG - Intergenic
1091506037 12:1069611-1069633 TACATCTGCCCTAAGTATTCTGG - Intronic
1101325530 12:103712276-103712298 GCCCTTCACCCTCAGTATCCTGG - Intronic
1119117988 14:72044920-72044942 GTTCTCCACCCTAGGGATTCTGG + Intronic
1127434026 15:58938738-58938760 AACCTCCACCTTACGCATTCAGG + Intronic
1128631222 15:69269591-69269613 GAGCTCCATACTAAGTTTTCAGG - Exonic
1128681143 15:69652615-69652637 CACCTCCATGCTAAGTATTATGG - Intergenic
1138327410 16:56187007-56187029 TACCTTCTCCCTAAGTACTCAGG - Intergenic
1146210509 17:30938889-30938911 GACCAACACCCTAAATATCCTGG + Intronic
1155590185 18:27419000-27419022 CACCTCCACCCCCAGTATTTGGG - Intergenic
1160844783 19:1161444-1161466 CACCTCCACCCCCAGTACTCAGG - Intronic
927939491 2:27094785-27094807 GGCCTCCACCCTAAGCTTCCTGG + Intronic
935743656 2:106172751-106172773 GACCTCTACCCTAAGGGATCTGG + Intronic
942624888 2:177889529-177889551 GAGGTCCAAACTAAGTATTCTGG - Intronic
944211524 2:197211121-197211143 GTCCTGCACCCTCAATATTCTGG + Intronic
947324666 2:228961411-228961433 GACCTCCTCCCTATGTCTGCTGG + Intronic
1172278573 20:33694596-33694618 GAGCTCCCCCCTTGGTATTCAGG + Intergenic
1175225413 20:57441428-57441450 GAGCTCCACCCTAAGAAGCCTGG + Intergenic
1176099402 20:63358158-63358180 GACCTCCAGCCTCAGTGTCCTGG - Intronic
1181325599 22:22043473-22043495 CATCTCCACCCTCACTATTCAGG + Intergenic
953042689 3:39268962-39268984 CACCTCCACCCTGGGTATCCTGG + Intronic
961825772 3:129598333-129598355 GACCTCCTCCCTCACCATTCTGG + Intronic
963631641 3:147738884-147738906 GACCTTCACCCTCTGTAGTCTGG + Intergenic
965209534 3:165767582-165767604 GACCTCCACAAGAACTATTCAGG + Intergenic
970252301 4:14128738-14128760 GATGTCCACCCCAAGTATGCTGG - Intergenic
970412712 4:15825086-15825108 GTCCTCCACACTAATCATTCAGG - Intronic
976979626 4:91210906-91210928 GAAATACACACTAAGTATTCGGG + Intronic
980823695 4:138048509-138048531 GACCTCCACCCTAAGTATTCAGG + Intergenic
986044885 5:4027233-4027255 GAACTCCACTCTAATTATCCTGG + Intergenic
987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG + Intronic
987080454 5:14420974-14420996 AACCTCCACCAGAAGTTTTCCGG - Intronic
990556425 5:56941250-56941272 GACCTACACCCCAAGAATACTGG + Intronic
991020056 5:61971258-61971280 GAACTCCAGCCTATGTTTTCAGG + Intergenic
1014251720 6:119122201-119122223 GACCTCCAGCCTTAGTGGTCAGG + Intronic
1048799662 8:138184298-138184320 GACTTCCATCCTAAGCAATCAGG + Intronic
1049434919 8:142582080-142582102 GAACTTCACCCAAAGGATTCTGG + Intergenic
1055433542 9:76269324-76269346 GACATCCAATCTAAGTGTTCAGG + Intronic
1057973750 9:99581887-99581909 GACATCCATCCTAAGTAGTGTGG + Intergenic
1061876130 9:133545039-133545061 GTCCTCTAACCTGAGTATTCTGG + Intronic
1186126125 X:6416010-6416032 AACCTCCACCCCAAGTCCTCTGG - Intergenic
1192891607 X:75397685-75397707 GACCTTCAACCGAAATATTCAGG + Intronic
1195155151 X:102115646-102115668 CACCTCCACCATTAGTAGTCAGG + Intergenic
1198635946 X:138700498-138700520 GAACTCCATCCTAAGTAATCTGG + Intronic
1202589782 Y:26470578-26470600 GACCTCCATCCTATGGCTTCAGG + Intergenic