ID: 980826371

View in Genome Browser
Species Human (GRCh38)
Location 4:138078493-138078515
Sequence GCACACTGACTAATCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980826367_980826371 13 Left 980826367 4:138078457-138078479 CCACCCACAAGTCAGTGTGGCCT No data
Right 980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG No data
980826370_980826371 -7 Left 980826370 4:138078477-138078499 CCTTGTTAGCTGCTCTGCACACT No data
Right 980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG No data
980826369_980826371 9 Left 980826369 4:138078461-138078483 CCACAAGTCAGTGTGGCCTTGTT No data
Right 980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG No data
980826368_980826371 10 Left 980826368 4:138078460-138078482 CCCACAAGTCAGTGTGGCCTTGT No data
Right 980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980826371 Original CRISPR GCACACTGACTAATCAAAAC TGG Intergenic
No off target data available for this crispr