ID: 980827347

View in Genome Browser
Species Human (GRCh38)
Location 4:138088898-138088920
Sequence TCGTGCTGGCCTGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980827339_980827347 3 Left 980827339 4:138088872-138088894 CCGCCGAGCCCACGCCCACCTAG No data
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827336_980827347 25 Left 980827336 4:138088850-138088872 CCGGCTGCTCCGAGTGCGAGGCC 0: 4
1: 201
2: 337
3: 415
4: 414
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827342_980827347 -6 Left 980827342 4:138088881-138088903 CCACGCCCACCTAGAACTCGTGC No data
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827338_980827347 4 Left 980827338 4:138088871-138088893 CCCGCCGAGCCCACGCCCACCTA No data
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827340_980827347 0 Left 980827340 4:138088875-138088897 CCGAGCCCACGCCCACCTAGAAC No data
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827334_980827347 29 Left 980827334 4:138088846-138088868 CCGGCCGGCTGCTCCGAGTGCGA 0: 5
1: 142
2: 284
3: 341
4: 378
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827337_980827347 16 Left 980827337 4:138088859-138088881 CCGAGTGCGAGGCCCGCCGAGCC 0: 3
1: 35
2: 352
3: 498
4: 410
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data
980827341_980827347 -5 Left 980827341 4:138088880-138088902 CCCACGCCCACCTAGAACTCGTG No data
Right 980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980827347 Original CRISPR TCGTGCTGGCCTGCAAGCGC CGG Intergenic
No off target data available for this crispr