ID: 980832789

View in Genome Browser
Species Human (GRCh38)
Location 4:138152053-138152075
Sequence CTTTGTAAAAGGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980832786_980832789 -4 Left 980832786 4:138152034-138152056 CCAATATAATCAGAAGGATCTTT No data
Right 980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG No data
980832783_980832789 2 Left 980832783 4:138152028-138152050 CCAAACCCAATATAATCAGAAGG No data
Right 980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG No data
980832785_980832789 -3 Left 980832785 4:138152033-138152055 CCCAATATAATCAGAAGGATCTT No data
Right 980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980832789 Original CRISPR CTTTGTAAAAGGAAGGTAGA AGG Intergenic
No off target data available for this crispr