ID: 980838390

View in Genome Browser
Species Human (GRCh38)
Location 4:138226455-138226477
Sequence CTGGATGCTCAGATAAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980838390_980838393 -3 Left 980838390 4:138226455-138226477 CCCTGCTTTATCTGAGCATCCAG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 980838393 4:138226475-138226497 CAGACATTGTACTCATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980838390 Original CRISPR CTGGATGCTCAGATAAAGCA GGG (reversed) Intronic
903447496 1:23431637-23431659 ATGGATGCTCAGAGAAGTCAGGG + Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
907934048 1:59026292-59026314 CTGGTTGCTCAGTGAAAGCTTGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
911098984 1:94079016-94079038 CTGGCTACTCAGATAAAGACAGG - Intronic
912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG + Intronic
918185772 1:182126517-182126539 CTGTGTTCTGAGATAAAGCAAGG - Intergenic
918795446 1:188888783-188888805 CTGCATGATTAGATAAAGTAGGG - Intergenic
919786900 1:201263885-201263907 ATTGAAGCTCAGATACAGCAAGG + Intergenic
920733952 1:208514179-208514201 CTGGAGGCCCTGTTAAAGCATGG - Intergenic
924629056 1:245720168-245720190 CTAGATGACCAGATAAATCATGG - Intergenic
1063666336 10:8062813-8062835 CTGGGTGCCCAGAGAAAGCCAGG - Intronic
1066391102 10:34977924-34977946 ATAGATGCTAAGATAAAGCCAGG + Intergenic
1067101242 10:43336257-43336279 CTGGAGGCTTGGAGAAAGCATGG - Intergenic
1069738218 10:70671478-70671500 CTGGATGCTCTGATGTAGCTTGG + Intergenic
1069769157 10:70886843-70886865 GTGGAACCTCAGAGAAAGCAAGG + Intronic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1070581846 10:77726580-77726602 GTGGATGCTCACATACATCAAGG - Intergenic
1071270450 10:84001948-84001970 ATGGAAGCTCAGAGAAGGCAGGG - Intergenic
1071431798 10:85612416-85612438 CTGGAGGCTCAGATAGTACAGGG - Intronic
1072158708 10:92746907-92746929 CGGAATGCTAAGATAAAGCCAGG - Intergenic
1075612094 10:123862491-123862513 CTGGATGCTCACAGTAAGAAAGG - Intronic
1075976875 10:126703754-126703776 CTGGAAGCTCTGAGAAAGGAAGG + Intergenic
1077369181 11:2173620-2173642 CTGGGTGCTGAGAGACAGCAGGG - Intergenic
1082894912 11:58179830-58179852 CAGGATGGTGACATAAAGCAGGG - Exonic
1084208848 11:67611671-67611693 CTGCAGCCTGAGATAAAGCAAGG + Intronic
1086837902 11:91648368-91648390 GTGGCTGCTCCCATAAAGCAGGG - Intergenic
1087130277 11:94663518-94663540 CTGGAAGCTAAGAGAAAGCACGG + Intergenic
1087962512 11:104369344-104369366 CTGGAAGGTCACATAAAGAAAGG + Intergenic
1088313602 11:108485559-108485581 CTGGAAGCTCAAAGAAAGCTTGG + Intronic
1088460495 11:110077323-110077345 TGTGATGCTCAGATAAAGGAAGG - Intergenic
1091348679 11:134874891-134874913 CTGGATGCTCACAGAAAAGATGG - Intergenic
1091903754 12:4165816-4165838 CTGGAGTCTCAGGAAAAGCAGGG - Intergenic
1096688524 12:53305173-53305195 CCTGATGCTCAGTTAAAACATGG - Intronic
1099186204 12:79518007-79518029 CTGAATGCCCAAATAAAGCCTGG + Intergenic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101473853 12:105025164-105025186 CTGGAAGCTGAGCTAAAACAAGG + Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG + Intergenic
1104409494 12:128546473-128546495 CTGGAAGCTCAGAACAAACAGGG - Intronic
1106982433 13:35303800-35303822 CAGGATGCTCAGAGAAAGATAGG - Intronic
1108338663 13:49473958-49473980 CTGGATACTAAAATAAATCAAGG + Intronic
1111161860 13:84405387-84405409 CTTGATGCTCAGCTTCAGCAAGG - Intergenic
1111594852 13:90398512-90398534 CTGGACACTCATATAAAGAAAGG + Intergenic
1113039408 13:106088597-106088619 CTGCTTCCTGAGATAAAGCAGGG + Intergenic
1113825267 13:113247681-113247703 CGGGATGCTCAAAGAAAGCCAGG + Intronic
1114630457 14:24156254-24156276 CTTCATTCTGAGATAAAGCAAGG + Intronic
1116323559 14:43500369-43500391 CCCAATGATCAGATAAAGCAAGG + Intergenic
1117575310 14:57091724-57091746 CTGGGTGCTGAAATACAGCAGGG + Intergenic
1118746381 14:68776435-68776457 CTGGATGCTGGGAGACAGCAAGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1130076053 15:80691392-80691414 CTGGATACTCAGTGAAATCAGGG - Intronic
1131966363 15:97848171-97848193 CTGGATTCTCAGATAAATGGAGG + Intergenic
1132407990 15:101556212-101556234 ATGGATGCTCAGCCAAAGTAGGG - Intergenic
1134112881 16:11526882-11526904 CTGGAAACTCAGACAAGGCAGGG - Intergenic
1135199051 16:20420814-20420836 CTGGATGATCAGCTAATCCACGG - Intronic
1135219643 16:20602863-20602885 CTGGATGATCAGCTAATCCACGG + Intergenic
1136859694 16:33691018-33691040 CAGGATGGTCACATAAAGGAGGG + Intergenic
1137415724 16:48276966-48276988 GGGGATGCTCAGAAAAATCATGG + Intronic
1139309445 16:66016142-66016164 CTGGAAGCTGAAAAAAAGCAAGG - Intergenic
1139851677 16:69954241-69954263 GTGGATGCTCAGAGATGGCAGGG + Intronic
1139880653 16:70177148-70177170 GTGGATGCTCAGAGATGGCAGGG + Intronic
1140260310 16:73372656-73372678 CTGGCTGCTCAGAATAACCATGG + Intergenic
1140371856 16:74418369-74418391 GTGGATGCTCAGAGATGGCAGGG - Intronic
1141206391 16:81936073-81936095 CTGGATGCTCAGATTATAAAAGG - Intronic
1203121200 16_KI270728v1_random:1539197-1539219 CAGGATGGTCACATAAAGGAGGG + Intergenic
1142911410 17:3096343-3096365 CTTGATTCACAGATACAGCAAGG + Intergenic
1145187771 17:20810429-20810451 CTGGTTGATCAGTTCAAGCAAGG - Intergenic
1145764603 17:27449701-27449723 TTGGAGGCTCTGATGAAGCATGG + Intergenic
1153636987 18:7121173-7121195 CTGGTTACTTAGATAAAGAATGG + Intergenic
1154322090 18:13362545-13362567 CTAGATGCATAGCTAAAGCATGG - Intronic
1160120150 18:76122722-76122744 CTGGATGTTCAGAGAAAGGCAGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
931106351 2:59060878-59060900 CTGGAAACTCAGGTAAACCAGGG - Intergenic
932559101 2:72851526-72851548 TTTGATGCTTAGATAAACCAGGG + Intergenic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
935717339 2:105950868-105950890 CTGGTTGCAGAGAAAAAGCAAGG - Intergenic
936285151 2:111175949-111175971 CTGGCTGCTTAGAGAAAGCCTGG + Intergenic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
940016865 2:149115662-149115684 CTGGAAGCTAAGATAACACATGG + Intronic
943792176 2:191945528-191945550 CAGGAAGCTCACATAAAGGACGG - Intergenic
946439241 2:219681068-219681090 CTGGATGATTAGACAAGGCAGGG + Intergenic
946861746 2:224006588-224006610 CTGGAAGCTCACGGAAAGCAGGG + Intronic
948972758 2:241441927-241441949 CTGGAAGCTCACACAAAGGAGGG - Intronic
1168961129 20:1870717-1870739 GTTGAGGCTCAGAGAAAGCAAGG - Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1175015732 20:55787977-55787999 CTGAATGCTCAGATAAATTCAGG - Intergenic
1175089976 20:56494444-56494466 GTAAATGCTCAGAAAAAGCAGGG - Intronic
1178858538 21:36270318-36270340 CGAGATGGGCAGATAAAGCAAGG + Intronic
1179358523 21:40683841-40683863 CAGGATGCTGAGAAAAAGCTTGG + Intronic
1180745858 22:18088430-18088452 CTGGAAGTTCAGAAAAAGCCTGG + Exonic
1183020245 22:35021020-35021042 CCGGATGCCCAGCCAAAGCAGGG - Intergenic
1183062370 22:35344233-35344255 CTGGATGGTGAGACAAGGCATGG + Intronic
1184416957 22:44357807-44357829 CAGGAGGCTCAGAGAAGGCAAGG - Intergenic
952850656 3:37725819-37725841 CTGGAGGCTTAGAGAAAGGATGG + Intronic
953071847 3:39528423-39528445 CTAGATGTTGAGAGAAAGCAGGG + Intronic
954964104 3:54595611-54595633 CAGGATGCTCAGGTGACGCATGG - Intronic
955516888 3:59734848-59734870 CTGGAGTCTCAGGAAAAGCAAGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
959400214 3:105891657-105891679 CTGGATTCTAAGAAAAATCAGGG - Intergenic
961481209 3:127182467-127182489 CTGGCTGCTCAGAGAAACAAGGG + Intergenic
962169975 3:133091155-133091177 CTAGATTCTTAGATAAAACATGG + Intronic
962369542 3:134809737-134809759 CTGCATGCTCAGATAAGGCAGGG - Intronic
964388678 3:156175882-156175904 CTCGATGCTGAGATAATGAAGGG + Intronic
964417357 3:156461325-156461347 CTGGAAGCTAAGAGGAAGCAAGG - Intronic
967043374 3:185714847-185714869 CTGAATACTGAGAAAAAGCAAGG - Intronic
967705759 3:192648911-192648933 ATGGATTCTCAAATAAATCAAGG + Intronic
972041347 4:34604043-34604065 TTGGATGGTAAGATAAGGCAGGG + Intergenic
972240044 4:37180739-37180761 CTAGCTGCTGAGATATAGCAAGG - Intergenic
973882501 4:55288168-55288190 CTTGATGCTAAGATCAAGCTGGG + Intergenic
974220002 4:58956001-58956023 CTGAATGTTCAGAGAAACCAAGG - Intergenic
976450587 4:85186013-85186035 CTGTAAGCTCTGTTAAAGCAAGG + Intergenic
976840132 4:89422739-89422761 CAGGAAGCTAAGAGAAAGCAGGG - Intergenic
979028378 4:115606323-115606345 CTGGATGCCTATAAAAAGCAGGG - Intergenic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
980401024 4:132286075-132286097 CTTGATGCTCAAGTAAAGCCAGG - Intergenic
980838390 4:138226455-138226477 CTGGATGCTCAGATAAAGCAGGG - Intronic
982437660 4:155397397-155397419 TTGGAGGCTCTGATAAAGCCTGG + Intergenic
984358111 4:178691387-178691409 CAGGATGCTCAGAGAATGCCAGG + Intergenic
985309834 4:188585672-188585694 CTGGATGCTCAGATTCTGCTGGG + Intergenic
986362311 5:6991420-6991442 CTGGATTCATAGCTAAAGCATGG - Intergenic
987007345 5:13724133-13724155 CTGGCTGGTGAGATAATGCAGGG - Intronic
988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG + Intergenic
988848438 5:35154276-35154298 CTGGATGCTCAAATAATTCAAGG + Intronic
989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG + Intronic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
991129894 5:63110435-63110457 TTGGATTCTCAGATACAACAAGG - Intergenic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
997853668 5:137354765-137354787 CTGGGTGCTGGGATACAGCAGGG - Intronic
1000756963 5:165173455-165173477 CTGAATCCTCACATAAAGGAGGG - Intergenic
1001056905 5:168457327-168457349 CTGTCTGCTGAGATATAGCAGGG + Intronic
1001199291 5:169701443-169701465 CTGAAGTCTCAGGTAAAGCATGG - Intronic
1001696982 5:173677994-173678016 TTGGGTGCTGAGATACAGCAGGG + Intergenic
1001739797 5:174043282-174043304 CTGGATGTTCATCTAAAGGAAGG - Intergenic
1001741087 5:174053292-174053314 CTGGATGCCCAGTGAAAGAAAGG - Intronic
1006066729 6:31467483-31467505 CTGGGTCCTCTTATAAAGCACGG + Intergenic
1006246264 6:32739545-32739567 CTGGATTCTGACAGAAAGCAGGG + Intergenic
1008230609 6:48982096-48982118 CTGGATGCTAAGAAGAAGTAAGG - Intergenic
1008453851 6:51685582-51685604 CTGGATGGTGAGATAACGAAAGG - Intronic
1008842464 6:55920510-55920532 CTGGATGCTATGATAATTCAAGG - Intergenic
1012279609 6:97313262-97313284 ATGGATGCTCAGAAAAAGTAAGG - Intergenic
1012636505 6:101549236-101549258 TTGGATGATCAAATAAAGGAGGG + Intronic
1014373948 6:120648471-120648493 CAGGATACTTAGATAAAGCATGG + Intergenic
1016792685 6:148082160-148082182 CTGGACTCACAGAAAAAGCACGG - Intergenic
1017735193 6:157356406-157356428 ACGGATGCTCAGACAAATCAGGG + Intergenic
1019469175 7:1209227-1209249 CTGAACGCTGAGAGAAAGCAGGG - Intergenic
1029489959 7:100865792-100865814 CTGCAGGCTCAGAGAAAGCCGGG - Exonic
1030230398 7:107202853-107202875 CTGGATCTTTAAATAAAGCAAGG - Exonic
1032998172 7:137471467-137471489 CTTGATCCTCAAATAAAGCCTGG + Intronic
1035756049 8:2033870-2033892 CTGGGAGCTCAGATAGGGCAAGG - Intergenic
1037806397 8:22059998-22060020 CTGGTGGCTCAGATAAGGCAGGG + Intronic
1038585543 8:28785568-28785590 CTGTATGCTCAGAGAAAGATGGG - Intronic
1040776077 8:51044674-51044696 CTGGATGATGAGATAGAGGATGG - Intergenic
1044775478 8:95682585-95682607 CTCCATGCAGAGATAAAGCAAGG - Intergenic
1049972317 9:832100-832122 CTGGATGCTCAGATAACATCAGG + Intergenic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1051376552 9:16408230-16408252 ATGGGTGCTCAGAGAAATCAAGG + Intergenic
1053487447 9:38470658-38470680 CTGAATGCCCAGCTAAGGCACGG - Intergenic
1056472850 9:86922871-86922893 CTGGAGGCTCAGCGAAGGCAGGG + Intergenic
1057895731 9:98907137-98907159 CTAGATTCTCAGATAAAGGAGGG + Intergenic
1058539384 9:105995695-105995717 CTGGAATCTCAGAAAAAGAAAGG + Intergenic
1059418533 9:114176715-114176737 CTGGATGCTCAGAGGTAGCTGGG + Intronic
1059573976 9:115470341-115470363 CTGGATGCTCAAAGCCAGCAGGG - Intergenic
1062679485 9:137770746-137770768 CTGGGTGCTCAGAGGAGGCAGGG - Intronic
1190839996 X:54134991-54135013 TGGGATCCTCAGAAAAAGCATGG + Exonic
1191058543 X:56269957-56269979 GTAGGTGCTCAGAGAAAGCATGG - Intronic
1191133526 X:57040359-57040381 CTGGATGATGAGACAAAGCAGGG + Intergenic
1194158459 X:90422261-90422283 CTGGATGGTGAGCTGAAGCAAGG + Intergenic