ID: 980842031

View in Genome Browser
Species Human (GRCh38)
Location 4:138275334-138275356
Sequence ATTGATATACAGATGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980842031_980842035 22 Left 980842031 4:138275334-138275356 CCAAGCTTCATCTGTATATCAAT No data
Right 980842035 4:138275379-138275401 CTACCATTGTACCCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980842031 Original CRISPR ATTGATATACAGATGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr