ID: 980843058

View in Genome Browser
Species Human (GRCh38)
Location 4:138290076-138290098
Sequence ATGTGATTATATAATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980843057_980843058 14 Left 980843057 4:138290039-138290061 CCTTAAAAATAATAATGTCAATT No data
Right 980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980843058 Original CRISPR ATGTGATTATATAATGAAGT TGG Intergenic
No off target data available for this crispr