ID: 980843149

View in Genome Browser
Species Human (GRCh38)
Location 4:138291191-138291213
Sequence CTTTCAATGGGAGAAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980843149_980843156 -9 Left 980843149 4:138291191-138291213 CCTCCCCCTTCTCCCATTGAAAG No data
Right 980843156 4:138291205-138291227 CATTGAAAGAGCACAATCCTAGG No data
980843149_980843157 -4 Left 980843149 4:138291191-138291213 CCTCCCCCTTCTCCCATTGAAAG No data
Right 980843157 4:138291210-138291232 AAAGAGCACAATCCTAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980843149 Original CRISPR CTTTCAATGGGAGAAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr