ID: 980846372

View in Genome Browser
Species Human (GRCh38)
Location 4:138330008-138330030
Sequence GACATGCATTTGCCTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980846368_980846372 25 Left 980846368 4:138329960-138329982 CCTACAGCCAATTCCTTTTGGTG No data
Right 980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG No data
980846370_980846372 12 Left 980846370 4:138329973-138329995 CCTTTTGGTGCGATTTAAATCTA No data
Right 980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG No data
980846369_980846372 18 Left 980846369 4:138329967-138329989 CCAATTCCTTTTGGTGCGATTTA No data
Right 980846372 4:138330008-138330030 GACATGCATTTGCCTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980846372 Original CRISPR GACATGCATTTGCCTACAGC TGG Intergenic
No off target data available for this crispr