ID: 980847804

View in Genome Browser
Species Human (GRCh38)
Location 4:138344847-138344869
Sequence AGAATCTCTCCTATGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980847802_980847804 10 Left 980847802 4:138344814-138344836 CCTTTTTAGAAAGATTGTGATTC No data
Right 980847804 4:138344847-138344869 AGAATCTCTCCTATGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980847804 Original CRISPR AGAATCTCTCCTATGAAGGA TGG Intergenic