ID: 980848054

View in Genome Browser
Species Human (GRCh38)
Location 4:138348011-138348033
Sequence GTTAACTGTGGACCACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980848051_980848054 8 Left 980848051 4:138347980-138348002 CCTTAATGAATAAGAGTTGCAAT No data
Right 980848054 4:138348011-138348033 GTTAACTGTGGACCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980848054 Original CRISPR GTTAACTGTGGACCACACCC AGG Intergenic
No off target data available for this crispr