ID: 980852591

View in Genome Browser
Species Human (GRCh38)
Location 4:138401135-138401157
Sequence GTGTTTATTTTCAGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980852591_980852595 -8 Left 980852591 4:138401135-138401157 CCCTACTCCCTGAAAATAAACAC No data
Right 980852595 4:138401150-138401172 ATAAACACCACTTGCTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980852591 Original CRISPR GTGTTTATTTTCAGGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr