ID: 980859910

View in Genome Browser
Species Human (GRCh38)
Location 4:138486602-138486624
Sequence CTCTGCCCTCCTCTGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980859910_980859913 -6 Left 980859910 4:138486602-138486624 CCACCATTCAGAGGAGGGCAGAG No data
Right 980859913 4:138486619-138486641 GCAGAGTCAAAAGGATCACAAGG No data
980859910_980859914 17 Left 980859910 4:138486602-138486624 CCACCATTCAGAGGAGGGCAGAG No data
Right 980859914 4:138486642-138486664 AATTGAACCTGTAGCCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980859910 Original CRISPR CTCTGCCCTCCTCTGAATGG TGG (reversed) Intergenic
No off target data available for this crispr