ID: 980861025

View in Genome Browser
Species Human (GRCh38)
Location 4:138499859-138499881
Sequence CTGTGGTACTATAGGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980861021_980861025 8 Left 980861021 4:138499828-138499850 CCAGGAGGTGGCGCTTTCAAGAG 0: 36
1: 246
2: 415
3: 449
4: 597
Right 980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG No data
980861019_980861025 15 Left 980861019 4:138499821-138499843 CCTCCAGCCAGGAGGTGGCGCTT 0: 35
1: 284
2: 471
3: 472
4: 560
Right 980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG No data
980861020_980861025 12 Left 980861020 4:138499824-138499846 CCAGCCAGGAGGTGGCGCTTTCA 0: 36
1: 263
2: 476
3: 417
4: 441
Right 980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980861025 Original CRISPR CTGTGGTACTATAGGTAGGA TGG Intergenic
No off target data available for this crispr