ID: 980862964

View in Genome Browser
Species Human (GRCh38)
Location 4:138521637-138521659
Sequence GGTGTTCAGGTACCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980862964_980862977 17 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862977 4:138521677-138521699 CAGAATGGCTTCTGGGAAAGGGG No data
980862964_980862976 16 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862976 4:138521676-138521698 CCAGAATGGCTTCTGGGAAAGGG No data
980862964_980862972 10 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862972 4:138521670-138521692 TCTGGCCCAGAATGGCTTCTGGG No data
980862964_980862979 27 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862979 4:138521687-138521709 TCTGGGAAAGGGGTGAGTGAGGG No data
980862964_980862971 9 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862971 4:138521669-138521691 TTCTGGCCCAGAATGGCTTCTGG No data
980862964_980862978 26 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862978 4:138521686-138521708 TTCTGGGAAAGGGGTGAGTGAGG No data
980862964_980862968 -8 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862968 4:138521652-138521674 TGAACACCAGGGCAAGTTTCTGG No data
980862964_980862970 2 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862970 4:138521662-138521684 GGCAAGTTTCTGGCCCAGAATGG No data
980862964_980862974 15 Left 980862964 4:138521637-138521659 CCTGCATGGGGTACCTGAACACC No data
Right 980862974 4:138521675-138521697 CCCAGAATGGCTTCTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980862964 Original CRISPR GGTGTTCAGGTACCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr