ID: 980864357

View in Genome Browser
Species Human (GRCh38)
Location 4:138536926-138536948
Sequence CATTATGGACAATGGTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980864352_980864357 -4 Left 980864352 4:138536907-138536929 CCAATTAAACCACTACAGCCATT No data
Right 980864357 4:138536926-138536948 CATTATGGACAATGGTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980864357 Original CRISPR CATTATGGACAATGGTATGT AGG Intergenic
No off target data available for this crispr