ID: 980870939

View in Genome Browser
Species Human (GRCh38)
Location 4:138610004-138610026
Sequence TTTCTATTTTCAGCTTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980870939_980870942 15 Left 980870939 4:138610004-138610026 CCTGGGTAAGCTGAAAATAGAAA No data
Right 980870942 4:138610042-138610064 CATGGTGCTAGTGCACAGTTTGG No data
980870939_980870943 16 Left 980870939 4:138610004-138610026 CCTGGGTAAGCTGAAAATAGAAA No data
Right 980870943 4:138610043-138610065 ATGGTGCTAGTGCACAGTTTGGG No data
980870939_980870941 -3 Left 980870939 4:138610004-138610026 CCTGGGTAAGCTGAAAATAGAAA No data
Right 980870941 4:138610024-138610046 AAAGTGGAACATCTGAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980870939 Original CRISPR TTTCTATTTTCAGCTTACCC AGG (reversed) Intergenic
No off target data available for this crispr