ID: 980871136

View in Genome Browser
Species Human (GRCh38)
Location 4:138612519-138612541
Sequence CTACCTAAACTGCTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980871136_980871142 25 Left 980871136 4:138612519-138612541 CCCAGCTCAAGCAGTTTAGGTAG No data
Right 980871142 4:138612567-138612589 CTCTGCTTTTTCTTCTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980871136 Original CRISPR CTACCTAAACTGCTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr