ID: 980871142

View in Genome Browser
Species Human (GRCh38)
Location 4:138612567-138612589
Sequence CTCTGCTTTTTCTTCTACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980871137_980871142 24 Left 980871137 4:138612520-138612542 CCAGCTCAAGCAGTTTAGGTAGG No data
Right 980871142 4:138612567-138612589 CTCTGCTTTTTCTTCTACGCAGG No data
980871136_980871142 25 Left 980871136 4:138612519-138612541 CCCAGCTCAAGCAGTTTAGGTAG No data
Right 980871142 4:138612567-138612589 CTCTGCTTTTTCTTCTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980871142 Original CRISPR CTCTGCTTTTTCTTCTACGC AGG Intergenic
No off target data available for this crispr