ID: 980871972 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:138622139-138622161 |
Sequence | TGGCAAACAGCAGTGGTGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
980871966_980871972 | 23 | Left | 980871966 | 4:138622093-138622115 | CCTGCTGGATCTGGAGGGGTGGA | 0: 15 1: 48 2: 81 3: 158 4: 318 |
||
Right | 980871972 | 4:138622139-138622161 | TGGCAAACAGCAGTGGTGCATGG | No data | ||||
980871964_980871972 | 24 | Left | 980871964 | 4:138622092-138622114 | CCCTGCTGGATCTGGAGGGGTGG | 0: 16 1: 50 2: 105 3: 152 4: 348 |
||
Right | 980871972 | 4:138622139-138622161 | TGGCAAACAGCAGTGGTGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
980871972 | Original CRISPR | TGGCAAACAGCAGTGGTGCA TGG | Intergenic | ||
No off target data available for this crispr |