ID: 980871972

View in Genome Browser
Species Human (GRCh38)
Location 4:138622139-138622161
Sequence TGGCAAACAGCAGTGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980871966_980871972 23 Left 980871966 4:138622093-138622115 CCTGCTGGATCTGGAGGGGTGGA 0: 15
1: 48
2: 81
3: 158
4: 318
Right 980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG No data
980871964_980871972 24 Left 980871964 4:138622092-138622114 CCCTGCTGGATCTGGAGGGGTGG 0: 16
1: 50
2: 105
3: 152
4: 348
Right 980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980871972 Original CRISPR TGGCAAACAGCAGTGGTGCA TGG Intergenic
No off target data available for this crispr