ID: 980873018

View in Genome Browser
Species Human (GRCh38)
Location 4:138631819-138631841
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980873015_980873018 22 Left 980873015 4:138631774-138631796 CCTTTTTCTCATTTGATGTTATT No data
Right 980873018 4:138631819-138631841 TTGGATAGTAAATCTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr