ID: 980873366

View in Genome Browser
Species Human (GRCh38)
Location 4:138635493-138635515
Sequence CTGAGAATATGCAGCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980873366_980873369 5 Left 980873366 4:138635493-138635515 CCATGATAGCTGCATATTCTCAG No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980873366 Original CRISPR CTGAGAATATGCAGCTATCA TGG (reversed) Intergenic
No off target data available for this crispr