ID: 980873369

View in Genome Browser
Species Human (GRCh38)
Location 4:138635521-138635543
Sequence GTACATTTAATAGCAACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980873365_980873369 6 Left 980873365 4:138635492-138635514 CCCATGATAGCTGCATATTCTCA No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873361_980873369 17 Left 980873361 4:138635481-138635503 CCAGTGCCCTCCCCATGATAGCT No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873362_980873369 11 Left 980873362 4:138635487-138635509 CCCTCCCCATGATAGCTGCATAT No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873366_980873369 5 Left 980873366 4:138635493-138635515 CCATGATAGCTGCATATTCTCAG No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873360_980873369 29 Left 980873360 4:138635469-138635491 CCAGAGGAAATTCCAGTGCCCTC No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873364_980873369 7 Left 980873364 4:138635491-138635513 CCCCATGATAGCTGCATATTCTC No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data
980873363_980873369 10 Left 980873363 4:138635488-138635510 CCTCCCCATGATAGCTGCATATT No data
Right 980873369 4:138635521-138635543 GTACATTTAATAGCAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980873369 Original CRISPR GTACATTTAATAGCAACCTT TGG Intergenic
No off target data available for this crispr