ID: 980874511

View in Genome Browser
Species Human (GRCh38)
Location 4:138647672-138647694
Sequence GGCTGAACACCACTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980874511_980874516 -4 Left 980874511 4:138647672-138647694 CCACCTCCCAGTGGTGTTCAGCC No data
Right 980874516 4:138647691-138647713 AGCCACATACCACCTGCTGCGGG No data
980874511_980874520 19 Left 980874511 4:138647672-138647694 CCACCTCCCAGTGGTGTTCAGCC No data
Right 980874520 4:138647714-138647736 AGAAGTGATCCCACTTCCTTAGG No data
980874511_980874515 -5 Left 980874511 4:138647672-138647694 CCACCTCCCAGTGGTGTTCAGCC No data
Right 980874515 4:138647690-138647712 CAGCCACATACCACCTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980874511 Original CRISPR GGCTGAACACCACTGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr