ID: 980879090

View in Genome Browser
Species Human (GRCh38)
Location 4:138691314-138691336
Sequence TAGGTTACCAAACCAGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980879083_980879090 29 Left 980879083 4:138691262-138691284 CCCCATTTTCAGGTGATGAAATC No data
Right 980879090 4:138691314-138691336 TAGGTTACCAAACCAGTTAGAGG No data
980879085_980879090 27 Left 980879085 4:138691264-138691286 CCATTTTCAGGTGATGAAATCAA No data
Right 980879090 4:138691314-138691336 TAGGTTACCAAACCAGTTAGAGG No data
980879084_980879090 28 Left 980879084 4:138691263-138691285 CCCATTTTCAGGTGATGAAATCA No data
Right 980879090 4:138691314-138691336 TAGGTTACCAAACCAGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980879090 Original CRISPR TAGGTTACCAAACCAGTTAG AGG Intergenic
No off target data available for this crispr