ID: 980884146

View in Genome Browser
Species Human (GRCh38)
Location 4:138743767-138743789
Sequence TAGGTATCCTTATGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980884146_980884149 7 Left 980884146 4:138743767-138743789 CCTGTTATTCATAAGGATACCTA No data
Right 980884149 4:138743797-138743819 TTGAGTATTTACTATATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980884146 Original CRISPR TAGGTATCCTTATGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr