ID: 980884149

View in Genome Browser
Species Human (GRCh38)
Location 4:138743797-138743819
Sequence TTGAGTATTTACTATATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980884144_980884149 19 Left 980884144 4:138743755-138743777 CCAATGTGCAATCCTGTTATTCA No data
Right 980884149 4:138743797-138743819 TTGAGTATTTACTATATGCTAGG No data
980884146_980884149 7 Left 980884146 4:138743767-138743789 CCTGTTATTCATAAGGATACCTA No data
Right 980884149 4:138743797-138743819 TTGAGTATTTACTATATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980884149 Original CRISPR TTGAGTATTTACTATATGCT AGG Intergenic
No off target data available for this crispr