ID: 980886915

View in Genome Browser
Species Human (GRCh38)
Location 4:138772798-138772820
Sequence TTCCCAGGACACTTCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980886915_980886918 14 Left 980886915 4:138772798-138772820 CCAACATAGAAGTGTCCTGGGAA No data
Right 980886918 4:138772835-138772857 CCTGTAAGTTAAGTTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980886915 Original CRISPR TTCCCAGGACACTTCTATGT TGG (reversed) Intergenic
No off target data available for this crispr