ID: 980893470

View in Genome Browser
Species Human (GRCh38)
Location 4:138838786-138838808
Sequence CAGGGTAAGGAGAGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980893470_980893478 0 Left 980893470 4:138838786-138838808 CCCGCGCCCCTCTCCTTACCCTG No data
Right 980893478 4:138838809-138838831 CAGACACACTGCAGACCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980893470 Original CRISPR CAGGGTAAGGAGAGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr