ID: 980894907

View in Genome Browser
Species Human (GRCh38)
Location 4:138852818-138852840
Sequence AGCTAAAATGATAGTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894907_980894909 7 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894909 4:138852848-138852870 CCCTGTCCTGATACTGCAGATGG No data
980894907_980894914 27 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894907_980894915 28 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG No data
980894907_980894911 8 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894911 4:138852849-138852871 CCTGTCCTGATACTGCAGATGGG No data
980894907_980894913 21 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894913 4:138852862-138852884 TGCAGATGGGAATAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894907 Original CRISPR AGCTAAAATGATAGTCTTCT TGG (reversed) Intergenic
No off target data available for this crispr