ID: 980894908

View in Genome Browser
Species Human (GRCh38)
Location 4:138852848-138852870
Sequence CCATCTGCAGTATCAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894908_980894914 -3 Left 980894908 4:138852848-138852870 CCCTGTCCTGATACTGCAGATGG No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894908_980894913 -9 Left 980894908 4:138852848-138852870 CCCTGTCCTGATACTGCAGATGG No data
Right 980894913 4:138852862-138852884 TGCAGATGGGAATAAGCAGATGG No data
980894908_980894915 -2 Left 980894908 4:138852848-138852870 CCCTGTCCTGATACTGCAGATGG No data
Right 980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894908 Original CRISPR CCATCTGCAGTATCAGGACA GGG (reversed) Intergenic
No off target data available for this crispr