ID: 980894910

View in Genome Browser
Species Human (GRCh38)
Location 4:138852849-138852871
Sequence CCCATCTGCAGTATCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894910_980894913 -10 Left 980894910 4:138852849-138852871 CCTGTCCTGATACTGCAGATGGG No data
Right 980894913 4:138852862-138852884 TGCAGATGGGAATAAGCAGATGG No data
980894910_980894914 -4 Left 980894910 4:138852849-138852871 CCTGTCCTGATACTGCAGATGGG No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894910_980894915 -3 Left 980894910 4:138852849-138852871 CCTGTCCTGATACTGCAGATGGG No data
Right 980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894910 Original CRISPR CCCATCTGCAGTATCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr