ID: 980894912

View in Genome Browser
Species Human (GRCh38)
Location 4:138852854-138852876
Sequence TTATTCCCATCTGCAGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894912_980894915 -8 Left 980894912 4:138852854-138852876 CCTGATACTGCAGATGGGAATAA No data
Right 980894915 4:138852869-138852891 GGGAATAAGCAGATGGAGCAGGG No data
980894912_980894916 29 Left 980894912 4:138852854-138852876 CCTGATACTGCAGATGGGAATAA No data
Right 980894916 4:138852906-138852928 TCATATAAACATGAAATGAAAGG No data
980894912_980894914 -9 Left 980894912 4:138852854-138852876 CCTGATACTGCAGATGGGAATAA No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894912 Original CRISPR TTATTCCCATCTGCAGTATC AGG (reversed) Intergenic
No off target data available for this crispr