ID: 980894912 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:138852854-138852876 |
Sequence | TTATTCCCATCTGCAGTATC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
980894912_980894915 | -8 | Left | 980894912 | 4:138852854-138852876 | CCTGATACTGCAGATGGGAATAA | No data | ||
Right | 980894915 | 4:138852869-138852891 | GGGAATAAGCAGATGGAGCAGGG | No data | ||||
980894912_980894916 | 29 | Left | 980894912 | 4:138852854-138852876 | CCTGATACTGCAGATGGGAATAA | No data | ||
Right | 980894916 | 4:138852906-138852928 | TCATATAAACATGAAATGAAAGG | No data | ||||
980894912_980894914 | -9 | Left | 980894912 | 4:138852854-138852876 | CCTGATACTGCAGATGGGAATAA | No data | ||
Right | 980894914 | 4:138852868-138852890 | TGGGAATAAGCAGATGGAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
980894912 | Original CRISPR | TTATTCCCATCTGCAGTATC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |