ID: 980894914

View in Genome Browser
Species Human (GRCh38)
Location 4:138852868-138852890
Sequence TGGGAATAAGCAGATGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894908_980894914 -3 Left 980894908 4:138852848-138852870 CCCTGTCCTGATACTGCAGATGG No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894907_980894914 27 Left 980894907 4:138852818-138852840 CCAAGAAGACTATCATTTTAGCT No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894912_980894914 -9 Left 980894912 4:138852854-138852876 CCTGATACTGCAGATGGGAATAA No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data
980894910_980894914 -4 Left 980894910 4:138852849-138852871 CCTGTCCTGATACTGCAGATGGG No data
Right 980894914 4:138852868-138852890 TGGGAATAAGCAGATGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894914 Original CRISPR TGGGAATAAGCAGATGGAGC AGG Intergenic
No off target data available for this crispr