ID: 980894916

View in Genome Browser
Species Human (GRCh38)
Location 4:138852906-138852928
Sequence TCATATAAACATGAAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980894912_980894916 29 Left 980894912 4:138852854-138852876 CCTGATACTGCAGATGGGAATAA No data
Right 980894916 4:138852906-138852928 TCATATAAACATGAAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980894916 Original CRISPR TCATATAAACATGAAATGAA AGG Intergenic
No off target data available for this crispr