ID: 980896494

View in Genome Browser
Species Human (GRCh38)
Location 4:138865591-138865613
Sequence AATGATAAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980896491_980896494 1 Left 980896491 4:138865567-138865589 CCTTTATACTCAGTGGTTTTTTG No data
Right 980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG No data
980896489_980896494 16 Left 980896489 4:138865552-138865574 CCACATTAATGGTATCCTTTATA No data
Right 980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980896494 Original CRISPR AATGATAAAGAGAAGGAGGA AGG Intergenic
No off target data available for this crispr