ID: 980901100

View in Genome Browser
Species Human (GRCh38)
Location 4:138905946-138905968
Sequence GAACCGCTGTTAGTTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980901098_980901100 -3 Left 980901098 4:138905926-138905948 CCTGGTGCCAAGAAAGTTAGGAA No data
Right 980901100 4:138905946-138905968 GAACCGCTGTTAGTTGTTCCTGG No data
980901095_980901100 11 Left 980901095 4:138905912-138905934 CCATGAAACGTGTCCCTGGTGCC No data
Right 980901100 4:138905946-138905968 GAACCGCTGTTAGTTGTTCCTGG No data
980901099_980901100 -10 Left 980901099 4:138905933-138905955 CCAAGAAAGTTAGGAACCGCTGT No data
Right 980901100 4:138905946-138905968 GAACCGCTGTTAGTTGTTCCTGG No data
980901097_980901100 -2 Left 980901097 4:138905925-138905947 CCCTGGTGCCAAGAAAGTTAGGA No data
Right 980901100 4:138905946-138905968 GAACCGCTGTTAGTTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980901100 Original CRISPR GAACCGCTGTTAGTTGTTCC TGG Intergenic
No off target data available for this crispr