ID: 980903479

View in Genome Browser
Species Human (GRCh38)
Location 4:138927280-138927302
Sequence ATGTCTCTTTAGCAGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980903479_980903482 7 Left 980903479 4:138927280-138927302 CCAGGAAACTGCTAAAGAGACAT No data
Right 980903482 4:138927310-138927332 TTTATAAAGATGAATATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980903479 Original CRISPR ATGTCTCTTTAGCAGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr