ID: 980904921

View in Genome Browser
Species Human (GRCh38)
Location 4:138939007-138939029
Sequence TGGTGACAACAGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980904916_980904921 23 Left 980904916 4:138938961-138938983 CCGATTTAACAGACGCAGGTGCC No data
Right 980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG No data
980904917_980904921 2 Left 980904917 4:138938982-138939004 CCTAACATGAGCAATGTCCGTGC No data
Right 980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980904921 Original CRISPR TGGTGACAACAGATGGAACA AGG Intergenic
No off target data available for this crispr